About   Help   FAQ
Epcamem2Rosza
Endonuclease-mediated Allele Detail
Summary
Symbol: Epcamem2Rosza
Name: epithelial cell adhesion molecule; endonuclease-mediated mutation 2, Roman Szabo
MGI ID: MGI:7539347
Synonyms: EpcamQ
Gene: Epcam  Location: Chr17:87943407-87958555 bp, + strand  Genetic Position: Chr17, 57.87 cM
Alliance: Epcamem2Rosza page
Mutation
origin
Strain of Origin:  FVB/NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 80 (AGG) in exon 4 was changed to glutamine (CAG) (p.R80Q) using sgRNAs (targeting GAGGAGGATAAAGCCCGAAG and TGACTCACAGCAAGTCTGGG) and an ssODN template with CRISPR/Cas9 technology. R80 is essential for matriptase-mediated cleavage of the encoded peptide. (J:340720)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Epcam Mutation:  31 strains or lines available
References
Original:  J:340720 Szabo R, et al., Early-onset tufting enteropathy in HAI-2-deficient mice is independent of matriptase-mediated cleavage of EpCAM. Development. 2023 Sep 1;150(17)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory