Epcamem2Rosza
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Epcamem2Rosza |
| Name: |
epithelial cell adhesion molecule; endonuclease-mediated mutation 2, Roman Szabo |
| MGI ID: |
MGI:7539347 |
| Synonyms: |
EpcamQ |
| Gene: |
Epcam Location: Chr17:87943407-87958555 bp, + strand Genetic Position: Chr17, 57.87 cM
|
| Alliance: |
Epcamem2Rosza page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Arginine codon 80 (AGG) in exon 4 was changed to glutamine (CAG) (p.R80Q) using sgRNAs (targeting GAGGAGGATAAAGCCCGAAG and TGACTCACAGCAAGTCTGGG) and an ssODN template with CRISPR/Cas9 technology. R80 is essential for matriptase-mediated cleavage of the encoded peptide.
(J:340720)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Epcam Mutation: |
31 strains or lines available
|
|
| Original: |
J:340720 Szabo R, et al., Early-onset tufting enteropathy in HAI-2-deficient mice is independent of matriptase-mediated cleavage of EpCAM. Development. 2023 Sep 1;150(17) |
| All: |
1 reference(s) |
|