About   Help   FAQ
Slc38a9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc38a9em1(IMPC)J
Name: solute carrier family 38, member 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7537145
Gene: Slc38a9  Location: Chr13:112797285-112875283 bp, + strand  Genetic Position: Chr13, 63.93 cM
Alliance: Slc38a9em1(IMPC)J page
IMPC: Slc38a9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAATAGTCAAGAGTCTCAC and GCCAGCAGGAGCTTAAGTTA, which resulted in a 1350 bp deletion beginning at Chromosome 13 position 112,689,111 bp and ending after 112,690,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000408687, ENSMUSE00000378819, ENSMUSE00000338903 (exons 4,5,6) and 1070 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 81 and early truncation 37 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc38a9 Mutation:  38 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory