Ptpn22^em1Rza
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptpn22^em1Rza
• Name: protein tyrosine phosphatase, non-receptor type 22 (lymphoid); endonuclease-mediated mutation 1, Rose Zamoyska
• MGI ID: MGI:7529473
• Synonyms: PTPN22^R619W
• Gene: Ptpn22 Location: Chr3:103767111-103819563 bp, + strand Genetic Position: Chr3, 45.52 cM, cytoband F3
• Alliance: Ptpn22^em1Rza page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 620 (CGG) in exon 14 was changed to tryptophan (TGG) (p.R619W) using a crRNA (targeting AAGACTCGGGTGTCCGTTCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R620W mutation associated with multiple autoimmune disease. This allele was created in mice containing the Tg(TcraTcrb)1100Mjb and Ptpn22^tm2.1Ciphe alleles. (J:304128)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ptpn22 Mutation: 50 strains or lines available

References

• Original: J:304128 Knipper JA, et al., PTPN22 Acts in a Cell Intrinsic Manner to Restrict the Proliferation and Differentiation of T Cells Following Antibody Lymphodepletion. Front Immunol. 2020;11:52
• All: 1 reference(s)