Tyr^em1Gfng
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tyr^em1Gfng
• Name: tyrosinase; endonuclease-mediated mutation 1, Guoping Feng
• MGI ID: MGI:7526756
• Synonyms: Tyr^C89S, Tyr^em1Guof
• Gene: Tyr Location: Chr7:87073979-87142637 bp, - strand Genetic Position: Chr7, 49.01 cM
• Alliance: Tyr^em1Gfng page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Cysteine codon 89 (TGC) was changed to serine (AGC) (p.C89S) using an sgRNA (targeting CCTGCCAGTGCTCAGGCAACTTC) and an ssODN template with CRISPR/Cas9 technology. This mutation is associated with albinism. (J:334099)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tyr Mutation: 382 strains or lines available

References

• Original: J:334099 Wilde JJ, et al., Efficient embryonic homozygous gene conversion via RAD51-enhanced interhomolog repair. Cell. 2021 Jun 10;184(12):3267-3280.e18
• All: 1 reference(s)