Spata31^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spata31^em1(IMPC)J
• Name: spermatogenesis associated 31; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7526416
• Gene: Spata31 Location: Chr13:65065220-65071008 bp, + strand Genetic Position: Chr13, 34.21 cM
• Alliance: Spata31^em1(IMPC)J page
• IMPC: Spata31 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAGGCATTCTCCCCAAGC and GTTCTCTACAGACATCTCTC, which resulted in a 2729 bp deletion beginning at Chromosome 13 position 64,920,298 bp and ending after 64,923,026 bp (GRCm38/mm10). This mutation deletes 2729 bp from ENSMUSE00000448525 (exon 3) and is predicted to cause a change of amino acid sequence after residue 86 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spata31 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)