Dpysl2^em1Jpka
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dpysl2^em1Jpka
• Name: dihydropyrimidinase-like 2; endonuclease-mediated mutation 1, Josef P Kapfhammer
• MGI ID: MGI:7526125
• Synonyms: CRMP2^ki, CRMP2-T555A
• Gene: Dpysl2 Location: Chr14:67040313-67148410 bp, - strand Genetic Position: Chr14, 34.6 cM
• Alliance: Dpysl2^em1Jpka page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Threonine codon 555 (ACC) in exon 14 was changed to alanine (GCC) (c.1663A>G, p.T555A) using a crRNA (targeting GGGTGCCACGATGCGCTGGGTGG) and an ssODN tempate with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphoblocker. (J:336786)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dpysl2 Mutation: 36 strains or lines available

References

• Original: J:336786 Winkler SC, et al., PKCgamma-Mediated Phosphorylation of CRMP2 Regulates Dendritic Outgrowth in Cerebellar Purkinje Cells. Mol Neurobiol. 2020 Dec;57(12):5150-5166
• All: 1 reference(s)