Cd70^em1Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cd70^em1Kmm
• Name: CD70 antigen; endonuclease-mediated mutation 1, Kenneth M Murphy
• MGI ID: MGI:7521995
• Synonyms: Cd70^fl
• Gene: Cd70 Location: Chr17:57452997-57456777 bp, - strand Genetic Position: Chr17, 29.69 cM, cytoband C-D
• Alliance: Cd70^em1Kmm page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Two guide RNAs (caatcgtgtccaaatatttt and cttgagcggccgggaggatt) are used to flank exon 1 with loxP sites. (J:333733)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cd70 Mutation: 12 strains or lines available

References

• Original: J:333733 Wu R, et al., Mechanisms of CD40-dependent cDC1 licensing beyond costimulation. Nat Immunol. 2022 Nov;23(11):1536-1550
• All: 1 reference(s)