About   Help   FAQ
Cd70em1Kmm
Endonuclease-mediated Allele Detail
Summary
Symbol: Cd70em1Kmm
Name: CD70 antigen; endonuclease-mediated mutation 1, Kenneth M Murphy
MGI ID: MGI:7521995
Synonyms: Cd70fl
Gene: Cd70  Location: Chr17:57452997-57456777 bp, - strand  Genetic Position: Chr17, 29.69 cM, cytoband C-D
Alliance: Cd70em1Kmm page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsTwo guide RNAs (caatcgtgtccaaatatttt and cttgagcggccgggaggatt) are used to flank exon 1 with loxP sites. (J:333733)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cd70 Mutation:  13 strains or lines available
References
Original:  J:333733 Wu R, et al., Mechanisms of CD40-dependent cDC1 licensing beyond costimulation. Nat Immunol. 2022 Nov;23(11):1536-1550
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory