1700017N19Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: 1700017N19Rik^em1(IMPC)J
• Name: RIKEN cDNA 1700017N19 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7519129
• Gene: 1700017N19Rik Location: Chr10:100426346-100454257 bp, + strand Genetic Position: Chr10, 51.51 cM
• Alliance: 1700017N19Rik^em1(IMPC)J page
• IMPC: 1700017N19Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCACACTGATGTCACGTGAC and ACGAGGCTCCACTAAATATG, which resulted in a 439 bp deletion beginning at Chromosome 10 position 100,594,971 bp and ending after 100,595,409 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000268647 (exon 3) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any 1700017N19Rik Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)