About   Help   FAQ
1700017N19Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 1700017N19Rikem1(IMPC)J
Name: RIKEN cDNA 1700017N19 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7519129
Gene: 1700017N19Rik  Location: Chr10:100426346-100454257 bp, + strand  Genetic Position: Chr10, 51.51 cM
Alliance: 1700017N19Rikem1(IMPC)J page
IMPC: 1700017N19Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCACACTGATGTCACGTGAC and ACGAGGCTCCACTAAATATG, which resulted in a 439 bp deletion beginning at Chromosome 10 position 100,594,971 bp and ending after 100,595,409 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000268647 (exon 3) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any 1700017N19Rik Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory