Mettl16em4Embrp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mettl16em4Embrp |
| Name: |
methyltransferase 16, N6-methyladenosine; endonuclease-mediated mutation 4, Ramesh S Pillai |
| MGI ID: |
MGI:7514381 |
| Synonyms: |
Mettl16 185PP-AA186, Mettl16em4Rspi |
| Gene: |
Mettl16 Location: Chr11:74661658-74716649 bp, + strand Genetic Position: Chr11, 45.76 cM, cytoband B4
|
| Alliance: |
Mettl16em4Embrp page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Proline codons 185 (CCT) and 186 (CCC) in exon 5 were changed to alanine (GCC and GCA) (p.P185_P186delinsAA) using an sgRNA (targeting ACTCCTGATGGATGCGCTTA) and an ssODN template with CRISPR/Cas9 technology. This mutation causes the encoded peptide to lose its RNA-binding activity.
(J:314427)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Mettl16 Mutation: |
70 strains or lines available
|
|
| Original: |
J:314427 Mendel M, et al., Splice site m(6)A methylation prevents binding of U2AF35 to inhibit RNA splicing. Cell. 2021 Jun 10;184(12):3125-3142.e25 |
| All: |
1 reference(s) |
|