Mettl16^em4Rspi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mettl16^em4Rspi
• Name: methyltransferase 16, N6-methyladenosine; endonuclease-mediated mutation 4, Ramesh S Pillai
• MGI ID: MGI:7514381
• Synonyms: Mettl16 185PP-AA186
• Gene: Mettl16 Location: Chr11:74661658-74716649 bp, + strand Genetic Position: Chr11, 45.76 cM, cytoband B4
• Alliance: Mettl16^em4Rspi page

Mutation origin

• Strain of Origin: (C57BL/6J x DBA/2J)F1/J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Proline codons 185 (CCT) and 186 (CCC) in exon 5 were changed to alanine (GCC and GCA) (p.P185_P186delinsAA) using an sgRNA (targeting ACTCCTGATGGATGCGCTTA) and an ssODN template with CRISPR/Cas9 technology. This mutation causes the encoded peptide to lose its RNA-binding activity. (J:314427)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mettl16 Mutation: 68 strains or lines available

References

• Original: J:314427 Mendel M, et al., Splice site m(6)A methylation prevents binding of U2AF35 to inhibit RNA splicing. Cell. 2021 Jun 10;184(12):3125-3142.e25
• All: 1 reference(s)