Axdnd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Axdnd1^em1(IMPC)J
• Name: axonemal dynein light chain domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7490386
• Gene: Axdnd1 Location: Chr1:156157985-156248743 bp, - strand Genetic Position: Chr1, 67.71 cM
• Alliance: Axdnd1^em1(IMPC)J page
• IMPC: Axdnd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCTGTTAATGGAATGTTCC and AAATACGCTGAAAGTGAGCA, which resulted in a 224 bp deletion beginning at Chromosome 1 position 156,395,410 bp and ending after 156,395,633 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244127 (exon 9) and 102 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 244 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Axdnd1 Mutation: 46 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)