Zfp605em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zfp605em1(IMPC)J |
Name: |
zinc finger protein 605; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7486743 |
Gene: |
Zfp605 Location: Chr5:110257958-110277660 bp, + strand Genetic Position: Chr5, 53.3 cM
|
Alliance: |
Zfp605em1(IMPC)J page
|
IMPC: |
Zfp605 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATATATCATTAAGCAAAAC and TTAAGGCAGGACAGTCCATC, which resulted in a 18,020 bp deletion beginning at Chromosome 5 position 110,111,841 bp and ending after 110,129,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309111, ENSMUSE00001300810, ENSMUSE00001293032, ENSMUSE00000692012 (exons 2, 3 ,4 and 5) and 15,088 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|