Ints8^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ints8^em2(IMPC)Tcp
• Name: integrator complex subunit 8; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:7464374
• Gene: Ints8 Location: Chr4:11199158-11254258 bp, - strand Genetic Position: Chr4, 5.08 cM
• Alliance: Ints8^em2(IMPC)Tcp page
• IMPC: Ints8 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cpf1/Cas12a ribonucleoprotein complexes with single guide RNAs having spacer sequences of CUAAGGGCACACAUUGUAGGU targeting the 5' side and UUCAGACAUUCUUCAGACGCU targeting the 3' side of a critical region (ENSMUSE00001290156 and ENSMUSE00001223878). This resulted in a 2121-bp deletion of Chr4 from 11227066 to 11229186 with insertion of CCTTA (GRCm39). (J:200814)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ints8 Mutation: 75 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)