About   Help   FAQ
Ints8em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ints8em2(IMPC)Tcp
Name: integrator complex subunit 8; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:7464374
Gene: Ints8  Location: Chr4:11199158-11254258 bp, - strand  Genetic Position: Chr4, 5.08 cM
Alliance: Ints8em2(IMPC)Tcp page
IMPC: Ints8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cpf1/Cas12a ribonucleoprotein complexes with single guide RNAs having spacer sequences of CUAAGGGCACACAUUGUAGGU targeting the 5' side and UUCAGACAUUCUUCAGACGCU targeting the 3' side of a critical region (ENSMUSE00001290156 and ENSMUSE00001223878). This resulted in a 2121-bp deletion of Chr4 from 11227066 to 11229186 with insertion of CCTTA (GRCm39). (J:200814)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ints8 Mutation:  75 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory