Fam227a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam227a^em1(IMPC)J
• Name: family with sequence similarity 227, member A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7447052
• Gene: Fam227a Location: Chr15:79496518-79543157 bp, - strand Genetic Position: Chr15, 37.81 cM, cytoband E2
• Alliance: Fam227a^em1(IMPC)J page
• IMPC: Fam227a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGAGCTCTACCCCAGGAT and CAGAGGCCCTTACCACCAGC, which resulted in a 481 bp deletion beginning at Chromosome 15 position 79,643,687 bp and ending after 79,644,167 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001325995 (exon 4) and 411 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 73 and early truncation 46 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam227a Mutation: 59 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)