About   Help   FAQ
Fam227aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fam227aem1(IMPC)J
Name: family with sequence similarity 227, member A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7447052
Gene: Fam227a  Location: Chr15:79496518-79543157 bp, - strand  Genetic Position: Chr15, 37.81 cM, cytoband E2
Alliance: Fam227aem1(IMPC)J page
IMPC: Fam227a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGAGCTCTACCCCAGGAT and CAGAGGCCCTTACCACCAGC, which resulted in a 481 bp deletion beginning at Chromosome 15 position 79,643,687 bp and ending after 79,644,167 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001325995 (exon 4) and 411 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 73 and early truncation 46 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fam227a Mutation:  59 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory