Nipsnap3b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nipsnap3b^em1(IMPC)J
• Name: nipsnap homolog 3B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7435701
• Gene: Nipsnap3b Location: Chr4:53011932-53022060 bp, + strand Genetic Position: Chr4, 28.57 cM, cytoband B3
• Alliance: Nipsnap3b^em1(IMPC)J page
• IMPC: Nipsnap3b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAGTCTCCGAACAAAGAT and CGTCGCTGTTAAGTACACAG, which resulted in a 10,575 bp deletion beginning at Chromosome 4 position 53,011,600 bp and ending after 53,022,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000814213, ENSMUSE00001033419, ENSMUSE00000995530, ENSMUSE00000980454, ENSMUSE00000987062, ENSMUSE00000413885 (exons 1-6) and 9023 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nipsnap3b Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)