Saa4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Saa4^em1(IMPC)J
• Name: serum amyloid A 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7344357
• Gene: Saa4 Location: Chr7:46377422-46382027 bp, - strand Genetic Position: Chr7, 30.53 cM
• Alliance: Saa4^em1(IMPC)J page
• IMPC: Saa4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCATGGATGGTCTACTCCA and GATGAACAAATGGTTAATGC, which resulted in a 4149 bp deletion beginning at Chromosome 7 position 46,727,816 bp and ending after 46,731,964 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000204208, ENSMUSE00000204214, ENSMUSE00000353026 (exons 2-4) and 2228 bp of flanking intronic sequence including the start sit, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Saa4 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)