Rr29^em4Axvi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr29^em4Axvi
• Name: regulatory region 29; endonuclease-mediated mutation 4, Axel Visel
• MGI ID: MGI:7334960
• Synonyms: Shh-pZRS^em4Axvi
• Gene: Rr29 Location: Chr5:29519495-29520860 bp, + strand
• Alliance: Rr29^em4Axvi page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: Sequence for Shh enhancer ZRS or MFCS1 (mammals-fish conserved sequence 1), located in intron 5 of Lmbr1, was replaced with the same length (1324 bp) orthologous Burmese python sequence (12,740-14,063 (Python_molurus_bivi ttatus-5.0.2-2355.6; Genebank ID AEQU02119490.1)) using an sgRNA (targeting AGTACCATGCGTGTGTGTGA) and a plasmid DNA template with CRISPR/Cas9 technology. (J:316049)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr29 Mutation: 2 strains or lines available

References

• Original: J:316049 Kvon EZ, et al., Progressive Loss of Function in a Limb Enhancer during Snake Evolution. Cell. 2016 Oct 20;167(3):633-642.e11
• All: 1 reference(s)