About   Help   FAQ
Rr29em3Axvi
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr29em3Axvi
Name: regulatory region 29; endonuclease-mediated mutation 3, Axel Visel
MGI ID: MGI:7334959
Synonyms: Shh-fZRSem3Axvi
Gene: Rr29  Location: Chr5:29519495-29520860 bp, + strand  
Alliance: Rr29em3Axvi page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region, Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsSequence for Shh enhancer ZRS or MFCS1 (mammals-fish conserved sequence 1), located in intron 5 of Lmbr1, was replaced with the same length (1324 bp) orthologous coelacanth sequence (JH127332:522,984-524,307 (latCha1)) using an sgRNA (targeting AGTACCATGCGTGTGTGTGA) and a plasmid DNA template with CRISPR/Cas9 technology. (J:316049)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr29 Mutation:  2 strains or lines available
References
Original:  J:316049 Kvon EZ, et al., Progressive Loss of Function in a Limb Enhancer during Snake Evolution. Cell. 2016 Oct 20;167(3):633-642.e11
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory