Clu^{em1(CLU*)Aduci}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clu^{em1(CLU*)Aduci}
• Name: clusterin; endonuclease-mediated mutation 1, Frank LaFerla
• MGI ID: MGI:7327106
• Synonyms: Clu-h2kbKI
• Gene: Clu Location: Chr14:66206093-66218992 bp, + strand Genetic Position: Chr14, 34.36 cM
• Alliance: Clu^{em1(CLU*)Aduci} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Inserted expressed sequence)
• Mutation: Insertion
• Clu^{em1(CLU*)Aduci} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  CLU (1191)

  Clu	(MGI:88423)

  2kb region of human DNA sequence, including a human SNP rs2279590

• Mutation details: Guide RNAs (GCAGATCCATATCTGGCTGA, TTGCCCCCTTCAGCCAGATA, TGAACTGCCCTCGCTTGTAC and CTTGAGTGCCTGTACAAGCG) are designed to replace part of the gene with an approximately 2kb region of human DNA sequence, including a human SNP rs2279590. To humanize the 3' end of the locus, the human SNP rs2279590 was introduced; the SNP has been associated with increased risk of late-onset Alzheimer's disease (LOAD). Specifically, DNA sequence from nucleotide position 27,596,915 to 27,598,786 (inclusive) on human chromosome 8 (GRCh38) is inserted between nucleotide positions 66,218,203 and 66,220,390 on mouse chromosome 14 (GRCm39), replacing the intervening mouse genomic DNA sequence. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Clu Mutation: 35 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)