Rr201^em1Cecad
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr201^em1Cecad
• Name: regulatory region 201; endonuclease-mediated mutation 1, CECAD, University of Cologne
• MGI ID: MGI:7286313
• Synonyms: PE Lhx5(-109kb)^-
• Gene: Rr201 Location: Chr5:120459966-120460991 bp Genetic Position: Chr5, Syntenic
• Alliance: Rr201^em1Cecad page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Using gRNAs (targeting TCTTTCAGCGATGATCCGGG and AGCGCGCTTAACAAGCATTA) with CRISPR/Cas9 technology, the poised enhancer located 109 kb upstream of Lhx5 was deleted. (J:307826)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr201 Mutation: 0 strains or lines available

References

• Original: J:307826 Crispatzu G, et al., The chromatin, topological and regulatory properties of pluripotency-associated poised enhancers are conserved in vivo. Nat Commun. 2021 Jul 16;12(1):4344
• All: 1 reference(s)