Del(3Rr80449-Rr80450)1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(3Rr80449-Rr80450)1Tcp
• Name: Del(3)1Tcp; deletion, Chr 3, The Centre for Phenogenomics 1
• MGI ID: MGI:7281504
• Synonyms: Chr3 SRR124-SRR134 del, Del1Tcp, Del(3)1Tcp, deltamENH, mSRR96-102 knockout
• Gene: Del(3Rr80449-Rr80450)1Tcp Location: unknown Genetic Position: Chr3, Syntenic

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Del(3Rr80449-Rr80450)1Tcp involves 2 genes/genome features (Rr80449, Rr80450) View all
• Mutation details: This allele from project TCPR1896 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGGATTTCTGATCCCTACGC targeting the 5' side and TAGCATACGTCACGCCGGAA targeting the 3' side of the target region on Chr3. This resulted in a 9,032-bp deletion Chr3:34800126 to 34809158 (GRCm39). (J:342012)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(3Rr80449-Rr80450)1Tcp Mutation: 0 strains or lines available

Notes

This deletes the mouse region homologous to the human SRR124-SRR134 region which is located 124-134 kb downstream of human SOX2.

References

• Original: J:342012 Abatti LE, et al., Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Nucleic Acids Res. 2023 Oct 27;51(19):10109-10131
• All: 1 reference(s)