About   Help   FAQ
Del(3Rr80449-Rr80450)1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(3Rr80449-Rr80450)1Tcp
Name: Del(3)1Tcp; deletion, Chr 3, The Centre for Phenogenomics 1
MGI ID: MGI:7281504
Synonyms: Chr3 SRR124-SRR134 del, Del1Tcp, Del(3)1Tcp, deltamENH, mSRR96-102 knockout
Gene: Del(3Rr80449-Rr80450)1Tcp  Location: unknown  Genetic Position: Chr3, Syntenic
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
  Del(3Rr80449-Rr80450)1Tcp involves 2 genes/genome features (Rr80449, Rr80450) View all
 
Mutation detailsThis allele from project TCPR1896 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGGATTTCTGATCCCTACGC targeting the 5' side and TAGCATACGTCACGCCGGAA targeting the 3' side of the target region on Chr3. This resulted in a 9,032-bp deletion Chr3:34800126 to 34809158 (GRCm39). (J:342012)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(3Rr80449-Rr80450)1Tcp Mutation:  0 strains or lines available
Notes
This deletes the mouse region homologous to the human SRR124-SRR134 region which is located 124-134 kb downstream of human SOX2.
References
Original:  J:342012 Abatti LE, et al., Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Nucleic Acids Res. 2023 Oct 27;51(19):10109-10131
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory