Casp8^em1Gne
Endonuclease-mediated Allele Detail

Summary

• Symbol: Casp8^em1Gne
• Name: caspase 8; endonuclease-mediated mutation 1, Genentech
• MGI ID: MGI:7259787
• Synonyms: Casp8^3xDA, Casp8^{D218A, D225A, D387A}
• Gene: Casp8 Location: Chr1:58834553-58886663 bp, + strand Genetic Position: Chr1, 29.19 cM, cytoband B
• Alliance: Casp8^em1Gne page

Mutation origin

• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: Zygotes carrying the Casp8^tm1.1Gne allele (where aspartic acid codon 387 (GAT) in exon 9 was mutated to alanine (GCC) (p.D387A) and the FRT site flanked neomycin selection gene cassette that was inserted into intron 9 was removed through subsequent flp-mediated recombination), were targeted with sgRNAs (targeting GTAAACTTTGTCTGAAGTC) and an ssODN template (CTGAGCACTTGGACATAGCCAGTGTCTGAGCTGCAGCATCAACCCCTGGATTGGGCTTGTGTTTTCCAGACCTCAGCTAAAGTTTACCAAATGAAGAACAAACCTCGGGGATACTGTCTGATCATCAACAATCATGATTTCAGCAAGGCCCGG) template using CRISPR/Cas9 technology to change aspartic acid codon 225 (GAC) in exon 8 to alanine (GCT) (p.D225A). Zygotes carrying these two alleles were then targeted with an sgRNA (targeting CAAGCTAGTGAGTCACGGGT) and an ssODN template (AGTGTGACGTTTTTTTGGTTGCTTGCAGAGATGAGCCTCAAAATGGCGGAACTGTGTGACTCGCCAAGAGAACAAGCTAGTGAGTCACGCGTAGGTGTGTCTCCTACCTCTCTCTTTGCATTGGTGTTCCTGTTTCCTTTGGTTGGTTCCTTT) to change aspartic acid codon 218 (GAC) in exon 8 to alanine (GCT) (p.D218A). (J:281456)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Casp8 Mutation: 45 strains or lines available

References

• Original: J:281456 Newton K, et al., Cleavage of RIPK1 by caspase-8 is crucial for limiting apoptosis and necroptosis. Nature. 2019 Oct;574(7778):428-431
• All: 1 reference(s)