B4galt1^em1Gidg
Endonuclease-mediated Allele Detail

Summary

• Symbol: B4galt1^em1Gidg
• Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1; endonuclease-mediated mutation 1, Giusy Della Gatta
• MGI ID: MGI:6886193
• Synonyms: B4galt1 353Ser, B4galt1 Asn353Ser knock-in
• Gene: B4galt1 Location: Chr4:40804602-40854005 bp, - strand Genetic Position: Chr4, 20.46 cM
• Alliance: B4galt1^em1Gidg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:317226
• Parent Cell Line: VGB6 (ES Cell)
• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting GAGGACGTACCTCTGAGGATTGG) and an ssODN template (ATGCTGTAGTAGGGAGGTGTCGAATGATCCGGCATTCAAGAGACAAGAAAAATGAGCCCAGTCCCCAGAGGTACGTCCTCTCTGTGCCTTCCCTTTATTTATTTATATGTTAGATTTATTT) with CRISPR/Cas9 technology, asparagine codon 353 (AAT) was changed to serine (AGT)(p.N353S). This mimics the human p.Asn352Ser mutation associated with protein glycosylation defects. (J:317226)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any B4galt1 Mutation: 44 strains or lines available

References

• Original: J:317226 Montasser ME, et al., Genetic and functional evidence links a missense variant in B4GALT1 to lower LDL and fibrinogen. Science. 2021 Dec 3;374(6572):1221-1227
• All: 1 reference(s)