About   Help   FAQ
B4galt1em1Gidg
Endonuclease-mediated Allele Detail
Summary
Symbol: B4galt1em1Gidg
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1; endonuclease-mediated mutation 1, Giusy Della Gatta
MGI ID: MGI:6886193
Synonyms: B4galt1 353Ser, B4galt1 Asn353Ser knock-in
Gene: B4galt1  Location: Chr4:40804602-40854005 bp, - strand  Genetic Position: Chr4, 20.46 cM
Alliance: B4galt1em1Gidg page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:317226
Parent Cell Line:  VGB6 (ES Cell)
Strain of Origin:  C57BL/6NTac
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsUsing an sgRNA (targeting GAGGACGTACCTCTGAGGATTGG) and an ssODN template (ATGCTGTAGTAGGGAGGTGTCGAATGATCCGGCATTCAAGAGACAAGAAAAATGAGCCCAGTCCCCAGAGGTACGTCCTCTCTGTGCCTTCCCTTTATTTATTTATATGTTAGATTTATTT) with CRISPR/Cas9 technology, asparagine codon 353 (AAT) was changed to serine (AGT)(p.N353S). This mimics the human p.Asn352Ser mutation associated with protein glycosylation defects. (J:317226)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any B4galt1 Mutation:  44 strains or lines available
References
Original:  J:317226 Montasser ME, et al., Genetic and functional evidence links a missense variant in B4GALT1 to lower LDL and fibrinogen. Science. 2021 Dec 3;374(6572):1221-1227
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory