About   Help   FAQ
Rab39bem5Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab39bem5Lutzy
Name: RAB39B, member RAS oncogene family; endonuclease-mediated mutation 5, Cathy Lutz
MGI ID: MGI:6879480
Synonyms: Rab39bdel11
Gene: Rab39b  Location: ChrX:74615652-74621837 bp, - strand  Genetic Position: ChrX, 38.26 cM
Alliance: Rab39bem5Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing using guide RNAs upstream (GTATTTACTAAAGGACTGTC and CTAAAGGACTGTCAGGAATC) and downstream (ATGAGCCTTCTTCCTAGGCC and CCTGTCAGAGATCCAGGCCT) were selected to target exon 2. Donor DNAs were originally designed to insert a G192R mutation and a silent mutation N196N in exon 2. DNA sequencing of the targeted region identified founder 6951 with an 11 bp deletion (indel). This strain does not contain the point mutations. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rab39b Mutation:  9 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory