Rab39b^em8Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab39b^em8Lutzy
• Name: RAB39B, member RAS oncogene family; endonuclease-mediated mutation 8, Cathleen Lutz
• MGI ID: MGI:6879474
• Synonyms: Rab39b^del654
• Gene: Rab39b Location: ChrX:74615652-74621837 bp, - strand Genetic Position: ChrX, 38.26 cM
• Alliance: Rab39b^em8Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing using guide RNAs upstream (GTATTTACTAAAGGACTGTC and CTAAAGGACTGTCAGGAATC) and downstream (ATGAGCCTTCTTCCTAGGCC and CCTGTCAGAGATCCAGGCCT) were selected to target exon 2. Donor DNAs were originally designed to introduce loxP sites flanking exon 2. DNA sequencing of the targeted region identified founder 5022 with a 6 bp insertion followed by a 654 bp deletion (GTATTTACTAAAGGAC/aggctc/TGT/del654/CAGGCTCATGTGTGGGTAGATAGGGAGC). (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab39b Mutation: 10 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)