Rab39b^em3Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab39b^em3Lutzy
• Name: RAB39B, member RAS oncogene family; endonuclease-mediated mutation 3, Cathleen Lutz
• MGI ID: MGI:6879425
• Synonyms: Rab39b^{Rab39b(G192R,N196N}
• Gene: Rab39b Location: ChrX:74615652-74621837 bp, - strand Genetic Position: ChrX, 38.26 cM
• Alliance: Rab39b^em3Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing used guide RNAs (TCTGAAGAATGAACAACATT and GGTTGGGAAGGGGTGAAGAG) to target exon 2. Donor DNAs were created to insert a G192R mutation (GGA to AGA, glycine to arginine) and a silent mutation N196N (AAT to AAC). The G192R (glycine to arginine) mutation has been identified in patients with X-linked dominant Parkinson's disease. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab39b Mutation: 10 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)