Nexmif^em6Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nexmif^em6Lutzy
• Name: neurite extension and migration factor; endonuclease-mediated mutation 6, Cathleen Lutz
• MGI ID: MGI:6867238
• Synonyms: Nexmif^ins1
• Gene: Nexmif Location: ChrX:103121040-103244791 bp, - strand Genetic Position: ChrX, 46.48 cM
• Alliance: Nexmif^em6Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing used guide RNAs [ATCTTCCTGCATCAGAAGAG, AATTCGATATGAGTCCTTTC] to target exon 4. Donor DNAs were originally designed to introduce a R322X mutation. The resulting indel mutation was identified as an insertion of a G in exon 4 upstream of the intended mutation. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nexmif Mutation: 54 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)