About   Help   FAQ
Nexmifem6Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Nexmifem6Lutzy
Name: neurite extension and migration factor; endonuclease-mediated mutation 6, Cathy Lutz
MGI ID: MGI:6867238
Synonyms: Nexmifins1
Gene: Nexmif  Location: ChrX:103121040-103244791 bp, - strand  Genetic Position: ChrX, 46.48 cM
Alliance: Nexmifem6Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs [ATCTTCCTGCATCAGAAGAG, AATTCGATATGAGTCCTTTC] to target exon 4. Donor DNAs were originally designed to introduce a R322X mutation. The resulting indel mutation was identified as an insertion of a G in exon 4 upstream of the intended mutation. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nexmif Mutation:  54 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory