Zcchc2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zcchc2em1(IMPC)J |
Name: |
zinc finger, CCHC domain containing 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6794045 |
Gene: |
Zcchc2 Location: Chr1:105918136-105961804 bp, + strand Genetic Position: Chr1, 49.76 cM
|
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC |
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAACTCTGATTAGCAACAT and GTTTTCACACTGATCATCAT, which resulted in a 377 bp deletion beginning at Chromosome 1 position 105,928,427 bp and ending after 105,928,803 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000540887 (exon 2) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 306 and early truncation 6 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|