Zcchc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Nomenclature

• Symbol: Zcchc2^em1(IMPC)J
• Name: zinc finger, CCHC domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6794045
• Gene: Zcchc2 Location: Chr1:105918136-105961804 bp, + strand Genetic Position: Chr1, 49.76 cM

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAACTCTGATTAGCAACAT and GTTTTCACACTGATCATCAT, which resulted in a 377 bp deletion beginning at Chromosome 1 position 105,928,427 bp and ending after 105,928,803 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000540887 (exon 2) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 306 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zcchc2 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)