Rag2^em3Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rag2^em3Lutzy
• Name: recombination activating gene 2; endonuclease-mediated mutation 3, Cathy Lutz
• MGI ID: MGI:6753157
• Synonyms: Rag2 del2,465
• Gene: Rag2 Location: Chr2:101455063-101462874 bp, + strand Genetic Position: Chr2, 53.87 cM
• Alliance: Rag2^em3Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Guide RNAs [TGTCTGTGATTTCCTAACGG ; TTCACCTAATCACAAGTAAC] were selected to target intronic DNA flanking exon 3. The allele is a 2,465-nt deletion (GTAGTGTCTGTGATT//del 2,465//AGGTGAATAAAGATGTCAA) that results in the complete loss of exon 3 from the genome. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rag2 Mutation: 121 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 9 reference(s)