Pnldc1^em2Jsha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pnldc1^em2Jsha
• Name: poly(A)-specific ribonuclease (PARN)-like domain containing 1; endonuclease-mediated mutation 2, Jiahao Sha
• MGI ID: MGI:6725158
• Synonyms: Pnldc1^delta1
• Gene: Pnldc1 Location: Chr17:13107616-13129117 bp, - strand Genetic Position: Chr17, 8.71 cM
• Alliance: Pnldc1^em2Jsha page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: The last exon was targeted with an sgRNA (targeting CCATGCCCTGAGAGCAGTGAGCC) using CRISPR/Cas9 technology, resulting in a 1 bp insertion (A/T) 5 bp before the end of the stop codon. (J:307453)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pnldc1 Mutation: 30 strains or lines available

References

• Original: J:307453 Zhang Y, et al., An essential role for PNLDC1 in piRNA 3' end trimming and male fertility in mice. Cell Res. 2017 Nov;27(11):1392-1396
• All: 1 reference(s)