Panx1^em2Icg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Panx1^em2Icg
• Name: pannexin 1; endonuclease-mediated mutation 2, Institute of Cytology and Genetics
• MGI ID: MGI:6724374
• Synonyms: Panx1^em2Koral/Icg
• Gene: Panx1 Location: Chr9:14917081-14956774 bp, - strand Genetic Position: Chr9, 4.52 cM
• Alliance: Panx1^em2Icg page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 216 (CGG) in exon 4 was targeted for a change to histidine (CAC) (p.R216H) using an sgRNA (targeting GAAATACATTAGCTGCCGGCTGG) and an ssODN (GAGGCTGAAGTAATAGCTCAAGTAGATACATGCCAACAGTATAACCACAAATGTCACCAGGTGGCAGCTAATGTATTTCATGATTAAATGACTAGAGTTCTTTTTTGTCTTCAAGTACTGCTC). The mutated amino-acid is conserved between human and mice and the mutation is found in a patient with symptoms of primary ovarian failure, severe intellectual disability, sensorineural hearing loss, and kyphosis. (J:307589)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Panx1 Mutation: 41 strains or lines available

References

• Original: J:307589 Battulin N, et al., Pannexin 1 Transgenic Mice: Human Diseases and Sleep-Wake Function Revision. Int J Mol Sci. 2021 May 17;22(10)
• All: 1 reference(s)