Cr2^{em1(CR2,CR1*)Adiuj)}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cr2^{em1(CR2,CR1*)Adiuj)}
• Name: complement receptor 2; endonuclease-mediated mutation 1, MODEL-AD Center
• MGI ID: MGI:6717167
• Synonyms: hCR1*T1610S
• Gene: Cr2 Location: Chr1:194819119-194859024 bp, - strand Genetic Position: Chr1, 98.44 cM
• Alliance: Cr2^{em1(CR2,CR1*)Adiuj)} page

Mutation origin

• Strain of Origin: B6(SJL)-Cr2^{tm1(CR2,CR1)How} Apoe^{tm1.1(APOE*4)Adiuj} Trem2^em1Adiuj/J

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence)
• Mutations: Insertion, Nucleotide substitutions
• Cr2^{em1(CR2,CR1*)Adiuj)} expresses 2 genes
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  CR1 (1378)

  Cr1l	(MGI:88513)

  T1610S

  human

  CR2 (1380)

  Cr2	(MGI:88489)

• Mutation details: Plasmids encoding guide RNAs (AAATCTGATGATCTCAGTGA and TAAATCTGATGATCTCAGTG) are designed to change ACC to TCA resulting in an threonine to serine mutation at amino acid 1610 (T1610S) in exon 29 of the human CR1 gene, which was previously inserted into the mouse Cr2 locus. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cr2 Mutation: 84 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)