About   Help   FAQ
Rab39bem1Jfch
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Rab39bem1Jfch
Name: RAB39B, member RAS oncogene family; endonuclease-mediated mutation 1, Jian-Fu Chen
MGI ID: MGI:6695910
Synonyms: Rab39b-
Gene: Rab39b  Location: ChrX:74615652-74621837 bp, - strand  Genetic Position: ChrX, 38.26 cM
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 2 was targeted with two gRNAs (targeting CCTGTAGTAGGCGCGAGTGA and AAGAGGTTATCAAATCAGAG), resulting in a 397 bp deletion. Western blots confirmed the absence of peptide expression in brain. (J:287752)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 3 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rab39b Mutation:  6 strains or lines available
References
Original:  J:287752 Zhang W, et al., Cerebral organoid and mouse models reveal a RAB39b-PI3K-mTOR pathway-dependent dysregulation of cortical development leading to macrocephaly/autism phenotypes. Genes Dev. 2020 Apr 1;34(7-8):580-597
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/17/2022
MGI 6.19
The Jackson Laboratory