Rab39b^em1Jfch
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab39b^em1Jfch
• Name: RAB39B, member RAS oncogene family; endonuclease-mediated mutation 1, Jian-Fu Chen
• MGI ID: MGI:6695910
• Synonyms: Rab39b^-
• Gene: Rab39b Location: ChrX:74615652-74621837 bp, - strand Genetic Position: ChrX, 38.26 cM
• Alliance: Rab39b^em1Jfch page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with two gRNAs (targeting CCTGTAGTAGGCGCGAGTGA and AAGAGGTTATCAAATCAGAG), resulting in a 397 bp deletion. Western blots confirmed the absence of peptide expression in brain. (J:287752)

Disease models

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rab39b Mutation: 10 strains or lines available

References

• Original: J:287752 Zhang W, et al., Cerebral organoid and mouse models reveal a RAB39b-PI3K-mTOR pathway-dependent dysregulation of cortical development leading to macrocephaly/autism phenotypes. Genes Dev. 2020 Apr 1;34(7-8):580-597
• All: 1 reference(s)