About   Help   FAQ
Del(8Ddx19a-Ddx19b)1Chaw
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(8Ddx19a-Ddx19b)1Chaw
Name: deletion, Chr 8, Changjiang Weng 1
MGI ID: MGI:6693696
Synonyms: Ddx19-Delta30919
Gene: Del(8Ddx19a-Ddx19b)1Chaw  Location: unknown  Genetic Position: Chr8, Syntenic
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Intergenic deletion, Intragenic deletion
 
Mutation detailsThe 3' UTR (in exon 12) of Ddx19a and exon 6 of Ddx19b were targeted using two pairs of TALENs (targeting TGGTACGGGTAAAACAGCTG, TGCAGGCTCTACTTGGCTGA, TAGCCCTGGCTTGGTGTGGT, TCTACCCTCCAAGTGCTG), resulting in the deletion of 30,919 bp of sequence including the 5' end of Ddx19a and 3' end of Ddx19b. (J:289833)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(8Ddx19a-Ddx19b)1Chaw Mutation:  0 strains or lines available
References
Original:  J:289833 Zhang K, et al., DDX19 Inhibits Type I Interferon Production by Disrupting TBK1-IKKepsilon-IRF3 Interactions and Promoting TBK1 and IKKepsilon Degradation. Cell Rep. 2019 Jan 29;26(5):1258-1272.e4
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory