About   Help   FAQ
Nlrc4em3Vnce
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Nlrc4em3Vnce
Name: NLR family, CARD domain containing 4; endonuclease-mediated mutation 3, Russell Vance
MGI ID: MGI:6508703
Synonyms: Nlrc4em3(S533D)Vnce, Nlrc4S533D
Gene: Nlrc4  Location: Chr17:74733254-74766140 bp, - strand  Genetic Position: Chr17, 45.64 cM
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsSerine codon 533 (TCA) was targeted with an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) and ssODN templates using CRISPR/Cas9 technology, changing it to aspartic acid codon GAT (p.S533D). This mutation creates a phosphomimetic residue at this position. Western blot experiments confirmed the expression of peptides from this allele. (J:294930)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nlrc4 Mutation:  46 strains or lines available
References
Original:  J:294930 Tenthorey JL, et al., NLRC4 inflammasome activation is NLRP3- and phosphorylation-independent during infection and does not protect from melanoma. J Exp Med. 2020 Jul 6;217(7)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/12/2022
MGI 6.17
The Jackson Laboratory