About   Help   FAQ
Nlrc4em1Vnce
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Nlrc4em1Vnce
Name: NLR family, CARD domain containing 4; endonuclease-mediated mutation 1, Russell Vance
MGI ID: MGI:6508701
Synonyms: Nlrc4-
Gene: Nlrc4  Location: Chr17:74733254-74766140 bp, - strand  Genetic Position: Chr17, 45.64 cM
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsA 1 bp insertion (or duplication of a T) was created using an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) with CRISPR/Cas9 technology. The resulting frameshift leads to a premature stop codon. Western blot experiments confirmed the lack of peptide expression from this allele. (J:294930)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nlrc4 Mutation:  46 strains or lines available
References
Original:  J:294930 Tenthorey JL, et al., NLRC4 inflammasome activation is NLRP3- and phosphorylation-independent during infection and does not protect from melanoma. J Exp Med. 2020 Jul 6;217(7)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/18/2022
MGI 6.17
The Jackson Laboratory