Slc16a5em#Memo
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc16a5em#Memo |
| Name: |
solute carrier family 16 (monocarboxylic acid transporters), member 5; endonuclease-mediated mutation 1, Marilyn E Morris |
| MGI ID: |
MGI:6476744 |
| Synonyms: |
Mct6- |
| Gene: |
Slc16a5 Location: Chr11:115353300-115365224 bp, + strand Genetic Position: Chr11, 80.84 cM
|
| Alliance: |
Slc16a5em#Memo page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: Exon 2 was targeted with sgRNAs (AGCATCTTGGTCAAACATTTCGG, CTGTGATCACTCCTGCGGTGAGG) using CRISPR/Cas9 technology, resulting in two mutant mouse lines: a 105 bp deletion and unknown size insertion in one line and a108 bp deletion in the other. The pound # symbol is used where the specific allele used is not mentioned or where the alleles are pooled.
(J:293663)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Slc16a5 Mutation: |
15 strains or lines available
|
|
| Original: |
J:293663 Jones RS, et al., Characterization and Proteomic-Transcriptomic Investigation of Monocarboxylate Transporter 6 Knockout Mice: Evidence of a Potential Role in Glucose and Lipid Metabolism. Mol Pharmacol. 2019 Sep;96(3):364-376 |
| All: |
2 reference(s) |
|