Slc16a5^em#Memo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc16a5^em#Memo
• Name: solute carrier family 16 (monocarboxylic acid transporters), member 5; endonuclease-mediated mutation 1, Marilyn E Morris
• MGI ID: MGI:6476744
• Synonyms: Mct6^-
• Gene: Slc16a5 Location: Chr11:115353300-115365224 bp, + strand Genetic Position: Chr11, 80.84 cM
• Alliance: Slc16a5^em#Memo page

Mutation origin

• Strain of Origin: C57BL/6NCr

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with sgRNAs (AGCATCTTGGTCAAACATTTCGG, CTGTGATCACTCCTGCGGTGAGG) using CRISPR/Cas9 technology, resulting in two mutant mouse lines: a 105 bp deletion and unknown size insertion in one line and a108 bp deletion in the other. The pound # symbol is used where the specific allele used is not mentioned or where the alleles are pooled. (J:293663)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc16a5 Mutation: 17 strains or lines available

References

• Original: J:293663 Jones RS, et al., Characterization and Proteomic-Transcriptomic Investigation of Monocarboxylate Transporter 6 Knockout Mice: Evidence of a Potential Role in Glucose and Lipid Metabolism. Mol Pharmacol. 2019 Sep;96(3):364-376
• All: 1 reference(s)