Wdr25^em1H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr25^em1H
• Name: WD repeat domain 25; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6451752
• Synonyms: WDRENHDEL-DEL1203-EM1-B6
• Gene: Wdr25 Location: Chr12:108860155-108994380 bp, + strand Genetic Position: Chr12, 59.7 cM
• Alliance: Wdr25^em1H page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AGGGTAATTAGGTGAAGGCG, GGAAATTCTCGCTTATGCCA, GGGAAATTCTCGCTTATGCC, and GGGTAATTAGGTGAAGGCGA. This resulted in deletion(s) of 1203 bp (location: Chr12:108871418-108872620; GRCm39), 1203 bp (location: Chr12:108871418-108872620; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wdr25 Mutation: 48 strains or lines available

References

• Original: J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013
• All: 2 reference(s)