About   Help   FAQ
Zfc3h1em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Zfc3h1em1(IMPC)Mbp
Name: zinc finger, C3H1-type containing; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6430662
Gene: Zfc3h1  Location: Chr10:115220864-115268677 bp, + strand  Genetic Position: Chr10, 63.51 cM
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences GTATTCTCTGGGTTGTTGTAAGG, TTTGGCTTCTCATACTTGCGTGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfc3h1 Mutation:  39 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/23/2022
MGI 6.20
The Jackson Laboratory