About   Help   FAQ
Endonuclease-mediated Allele Detail
Symbol: Fahem1(IMPC)Mbp
Name: fumarylacetoacetate hydrolase; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6423839
Gene: Fah  Location: Chr7:84234367-84255150 bp, - strand  Genetic Position: Chr7, 48.36 cM
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CCCTGAGCTGTGAACGTCACACG, CAATTCCACAGGCCGGTGATAGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
View phenotypes and curated references for all genotypes (concatenated display).
In Structures Affected by this Mutation: 8 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fah Mutation:  28 strains or lines available
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
MGI 6.20
The Jackson Laboratory