About   Help   FAQ
Endonuclease-mediated Allele Detail
Symbol: Celsr1em1(IMPC)Mbp
Name: cadherin, EGF LAG seven-pass G-type receptor 1; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6423825
Gene: Celsr1  Location: Chr15:85783130-85918404 bp, - strand  Genetic Position: Chr15, 40.42 cM
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences GCCAGCCTTGTGACACGCATAGG, TCAGCTATCGTCTATCATCGAGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Celsr1 Mutation:  68 strains or lines available
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
MGI 6.17
The Jackson Laboratory