Kcnj8^em1Nich
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnj8^em1Nich
• Name: potassium inwardly-rectifying channel, subfamily J, member 8; endonuclease-mediated mutation 1, Colin G Nichols
• MGI ID: MGI:6389009
• Synonyms: Kir6.1^VM
• Gene: Kcnj8 Location: Chr6:142510563-142517340 bp, - strand Genetic Position: Chr6, 74.31 cM
• Alliance: Kcnj8^em1Nich page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA/J)F2

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/Cas9 technology using gRNA 5' ACGCCACTTCAGGTCTACCA 3' introduced a G to A change at position 193 and an A to G change at position 195 resulting in a valine to methionine substitution at amino acid 65 (V65M). This corresponds to the human V65M mutation associated with Cantu Syndrome. (J:281903)

Disease models

Expression

In Structures Affected by this Mutation:

12 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kcnj8 Mutation: 27 strains or lines available

References

• Original: J:281903 Huang Y, et al., Cardiovascular consequences of KATP overactivity in Cantu syndrome. JCI Insight. 2018 Aug 9;3(15)
• All: 4 reference(s)