Scfd1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scfd1^em1(IMPC)Tcp
• Name: Sec1 family domain containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6383384
• Synonyms: Scfd1^-
• Gene: Scfd1 Location: Chr12:51424296-51496887 bp, + strand Genetic Position: Chr12, 22.11 cM, cytoband C1
• Alliance: Scfd1^em1(IMPC)Tcp page
• IMPC: Scfd1 gene page

Scfd1^em1(IMPC)Tcp/Scfd1^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. In vitro, some blastocysts fail to hatch from the zona pellucida and do not form outgrowths while others do hatch but form outgrowths with no inner cell mass and dispersed trophectoderm.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences CAAAACAACTACGGAGTTAG and GCTTAGTGACTGATCGCAGT that targeted exon(s) ENSMUSE00000113499.4 ENSMUSE00000113509.4 ENSMUSE00001605743.1 ENSMUSE00001605745.1. This resulted in deletion(s) of 1621 bp (location: Chr12:51435698-51437318; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Scfd1 Mutation: 33 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)