Plppr5^em3(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plppr5^em3(IMPC)H
• Name: phospholipid phosphatase related 5; endonuclease-mediated mutation 3, Harwell
• MGI ID: MGI:6382400
• Gene: Plppr5 Location: Chr3:117368274-117483157 bp, + strand Genetic Position: Chr3, 51.21 cM, cytoband G2
• Alliance: Plppr5^em3(IMPC)H page
• IMPC: Plppr5 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences CCTCAGCAATTGTTGTAATGGTG, CCACGTGAATGGGCTTAGGATGC, GTGTAATTTAGAGAACTGCCTGG, GAGGTGTTACCCACGTGAATGGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Plppr5 Mutation: 21 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)