Rr174^em1Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr174^em1Kmm
• Name: regulatory region 174; endonuclease-mediated mutation 1, Kenneth Murphy
• MGI ID: MGI:6368524
• Synonyms: Irf8 -50^-, Irf8^em3Kmm
• Gene: Rr174 Location: Chr8:121412733-121413283 bp Genetic Position: Chr8, Syntenic
• Alliance: Rr174^em1Kmm page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Plasmids encoding sgRNA (ggtgacatctgtctacggag, and atgcacccaaggcctggctc) are designed to delete one of the enhancers located in the super-enhancer region of the gene -50 kb upstream from the transcriptional start site. The region contains two PU.1 (Spi1)-binding sites. (J:279982)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr174 Mutation: 0 strains or lines available

References

• Original: J:279982 Durai V, et al., Cryptic activation of an Irf8 enhancer governs cDC1 fate specification. Nat Immunol. 2019 Sep;20(9):1161-1173
• All: 1 reference(s)