About   Help   FAQ
Mir217em1Uf
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Mir217em1Uf
Name: microRNA 217; endonuclease-mediated mutation 1, University of Florida
MGI ID: MGI:6361480
Gene: Mir217  Location: Chr11:28713728-28713835 bp, + strand  Genetic Position: Chr11, 16.23 cM
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
  Mir217em1Uf involves 1 genes/genome features (Mir217hg) View all
    CRISPR-targeting of the seed sequence deleted 28 bp (TTGCAGATACTGCATCAGGAACTGACTG). (J:278847)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mir217 Mutation:  0 strains or lines available
References
Original:  J:278847 Sutaria DS, et al., Knockout of Acinar Enriched microRNAs in Mice Promote Duct Formation But Not Pancreatic Cancer. Sci Rep. 2019 Jul 31;9(1):11147
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory