About   Help   FAQ
Rnf180em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf180em1(IMPC)J
Name: ring finger protein 180; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6360732
Gene: Rnf180  Location: Chr13:105267075-105431406 bp, - strand  Genetic Position: Chr13, 56.92 cM, cytoband D1
Alliance: Rnf180em1(IMPC)J page
IMPC: Rnf180 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAACGATGGCTACAGAAGC and CAGTTTCCCAACTGTCCACT, which resulted in a 953 bp deletion beginning at Chromosome 13 position 105,249,611 bp and ending after 105,250,563 bp (GRCm38/mm10). This mutation deletes 953 bp of ENSMUSE00000436977 (exon 4) and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 11 amino acids later. There is a 1 bp (A) insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnf180 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory