About   Help   FAQ
Gm5447em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gm5447em1(IMPC)J
Name: predicted gene 5447; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6360721
Gene: Gm5447  Location: Chr13:31158147-31160231 bp, + strand  Genetic Position: Chr13, 13.33 cM
Alliance: Gm5447em1(IMPC)J page
IMPC: Gm5447 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTGCCCAAGAGTCCACAG and CCATAAGCCCTAAGGTTTGA, which resulted in a 211 bp deletion beginning at Chromosome 13 position 30,974,433 bp and ending after 30,974,643 bp (GRCm38/mm10). This mutation deletes 211 bp of non-coding ENSMUSE00000431669 (exon 1) and is predicted to result in disruption of the regulatory build in this genome region. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gm5447 Mutation:  3 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory