Sepsecs^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sepsecs^em1(IMPC)Tcp
• Name: Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6356808
• Synonyms: Sepsecs^-
• Gene: Sepsecs Location: Chr5:52797429-52827050 bp, - strand Genetic Position: Chr5, 28.44 cM
• Alliance: Sepsecs^em1(IMPC)Tcp page
• IMPC: Sepsecs gene page

Sepsecs^em1(IMPC)Tcp/Sepsecs^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos exhibit severe developmental delay as small egg cylinders, poorly organized extraembryonic tissues, and failure of gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AAAGACAACACATTAACCAG, CAGACAAATAAGACGAACTG, GCCACCATCTTTATTACTAG, and TTGCAGTTCATTTGCTAAGT that targeted exon(s) ENSMUSE00001279971.2. This resulted in deletion(s) of 778 bp (location: Chr5:52821155-52821932; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sepsecs Mutation: 25 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)