Tmem74^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem74^em2(IMPC)Tcp
• Name: transmembrane protein 74; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316225
• Gene: Tmem74 Location: Chr15:43728042-43733432 bp, - strand Genetic Position: Chr15, 16.82 cM
• Alliance: Tmem74^em2(IMPC)Tcp page
• IMPC: Tmem74 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0740 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and three guide RNAs with spacer sequences of AGTGGACCCATGCAATGCTT and CAAACAAGCTTCTCCCTATC targeting the 5' side and TCTGGAACTGTCCTTGGTAG targeting the 3' side of exon ENSMUSE00000452230 resulting in a 838-bp deletion of Chr15 from 43866756 to 43867593 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tmem74 Mutation: 29 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)