About   Help   FAQ
Qkiem2Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Qkiem2Tcp
Name: quaking, KH domain containing RNA binding; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316208
Gene: Qki  Location: Chr17:10425480-10538706 bp, - strand  Genetic Position: Chr17, 7.75 cM
Alliance: Qkiem2Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele from project TCPR0749 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleotproing complexes with two single guide RNAs with the spacer sequences TGCCTCAGCAAGATTTAAAC and GGTTCAAGCTATGGATTCTG along with a long single-strand DNA template with loxP sites inserted at the Cas9 cut sites flanking exon ENSMUSE00000269846. (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Qki Mutation:  28 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory